TITLE: REBIRTHS

AUTHOR: C. L. Furlong

DATE: February 09, 2001

FINISHED: February 23, 2001

LAST REVISION: 24 February, 2001

E-MAIL: chance_lizard_furlong@aeiou.pt

RATING: PG

SUMMARY: Dr. Harley Street ("The Ci-kat-a") and Dr. Viper join forces

to conquer Megakat City. Who will defend it against those villains?

The Enforcers? A new group of vigilantes? Or someone else?...

DISCLAIMER: SWAT Kats and anything related to the series are the property

of Hanna-Barbera. No infringement is intended and no profit is gained

with this fiction.

COMMENTS: (They're a little bit long but they are worth the reading) It's a somewhat

shorter fic than my previous one and this time with no blood on it (well, maybe

only a little bit) though it's rated R (see below to discover why). This and

maybe a few future fics may tend to center more on T-Bone/Chance than on

Razor/Jake. Yes, T-Bone is my favorite character but I like Razor too and the

SWAT Kats don't exist without each other. I'll try to give the same amount of

attention to both of them but forgive me if one of them (generally T-Bone)

gets more attention than the other.

Now a little explanation. In most places you read "It's quite simple..." to do

this or that, well... it's really not *that* simple. I'm just assuming kats are

a little more evolved than we are. Besides I don't want to bore you with

technical details.

The second part of the prologue of this fiction has been inspired by Robin

Cook's "Terminal," a book which I *strongly* recommend, as well as the rest of

his series. And, speaking of the prologue, you might like to know that you don't have

to read it to understand the plot of this fiction. If you have a queasy stomach,

please, follow my advice and *DON'T* read it.

     Once again, despite my best efforts in trying to write in proper English,

if you find any grammar or spelling errors in this fiction, please try to remember

that I'm writing in a foreign language, and I do not live in an English-speaking

country. And *do* let me know what you think of this fiction so I can do

something better next time, okay? Questions and comments will all have their answer

(it'll only take you a few minutes and you'll be *really* helping me out!).

     Thanks to Kristen Sharpe for her support, comments and proofreading on my

previous fiction. Also her fiction "T-Bone Too - From the Darkest Hour of the

Night..." (*read it* in case you haven't) has inspired me on my brief descriptions of

Viper's Lab, although they may differ a bit from hers.

     Thanks to KS Claw for her fics about Viper (namely "Claws of the Marekat

- 1 and 2", "Enter the Cobra" and "3 Mutants is 1 Too Many") which helped me to

look at Viper from a slightly different angle.

     Though I didn't mention it on my previous fiction's "Comments" ("mea culpa"),

I'd really like to thank Glen Battilana for inspiring me with his fics on the

fighting sequences between the SWAT Kats and Dark Kat. Though our writing styles may

differ a bit, I think we see eye to eye in most aspects.

     Cheers to all of you, SK fans!

-----------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------

"We're ba-aaack!" - T-Bone (Chance Furlong) in "The PastMaster Always Rings

Twice"

-----------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------

PROLOGUE

 »»» Five days after the destruction of Megakat City Courthouse «««

 "How many kats know this?" - the bearded orange-furred tom-kat asked.

 Commander Feral rubbed his five-day beard, thinking.

 "Me, my niece, Miss Briggs and now you. The families don't know anything yet."

- he responded.

 Dr. Conway turned his back to the huge kat and walked to the large window of

Feral's office. He stared outside for a while, watching the sun set behind the

skyscrapers.  What he was about to ask clearly violated all codes of ethics a scientist

could have.  Even though it was their best hope.

 "I think it's better if the families are never told of what we're about to do,

Commander."

 He paused and closed his eyes, praying he was doing the right thing.

 "Can you do it today, Commander?" He turned to look at the huge brown kat.

 "I'll do it myself tonight. Count on it in your lab by tomorrow morning."

 "One more thing. I'll need to contact someone else to help me do the job."

 Feral frowned. He didn't want any more kats than those strictly needed. His own

job was at stake if something made its way outside.

 "Who?"

 "Prof. Hackle," - Dr. Conway said.

 Feral seemed to relax a bit. He knew the old kat wouldn't refuse. And he knew

he could count on his discretion.

 "I'll need the lab completely sealed! No one should get in nor out while we're

doing it!"

 "That's not a problem. Forget you're in Enforcer Headquarters?" - Feral said,

assuming a cocky stance.

 "I'd feel a lot safer if the SWAT Kats were still alive... So, I guess I'll just

have to count on your Enforcers... I'll be looking forward to see the package on

my desk tomorrow morning. You know what to do."

 Dr. Conway headed for the door.

 Feral sat in his chair behind his desk.

 "Don't worry, Conway. I know what to do."

-----------------------------------------------------------------------------------------

 "Bye, Gus. Hope this is tonight's last shipment!" - the morgue attendant said

to the hospital driver as he took the stretchers inside.

 "Want it, didn't you? See you later!"

 The ambulance drove out the service door of the city morgue.

 While the attendant was carrying the newly arrived corpses inside, two forms

dressed in tight black suits slipped inside and hid behind the spare stretchers. They

waited for the attendant to return and close the garage-like service door.

 "Now, look at the time! Five to midnight! It's almost 'lunch' time! I guess I

might as well get a bite of something before I go back to my desk."

 The attendant stepped out of the service bay and went upstairs, towards the

cafeteria.

 The two figures came out of their hiding place and headed along the dark

corridor that connected the service bay to the morgue. They entered the I.D. room

and searched the walls of long drawers, looking at the dates.

 They found the date they were looking for. They opened the drawers and unzipped

the black bags in order to make sure those were the ones they were looking for.

 They were.

 Swiftly, they zipped the bags shut and removed the corpses. They took them to

the 'pit,' the affectionate name the pathologists there used to call the autopsy

room.  Once there, they placed the bags onto two stainless steel tables and unzipped

them.  They turned the corpses around so their backs were facing up.

 They took off two bistouries from a tray and made an incision from ear to ear

passing by the scruff of the kats' necks. The larger dark figure grabbed the

upper portion of the incision and tugged it. With a noise similar to a root being

unearthed, the dead kat's scalp separated from the rest of the skull. The burly

form pulled it completely over the face of the kat. The smaller one looked to

the other side when the bigger one did the same to the other kat.

 "I need your help now, Felina!" - Feral said as he reached for a bone-saw and

plugged it. - "Grab his head tightly!"

 He turned on the saw and it made a heck of a noise. Fortunately, the 'pit' was

located in the basement, so every sound would be muffled by the building on top

of them. Besides, it was 'lunch' time and all of the morgue workers would be in

the cafeteria two stories above.

 "I'll make it up to you, sweetheart, I promise!"

 "Just get this done! And *don't* call me that! I'm not a kitten anymore!"

- she answered as she grabbed the kat's skull by both sides of his face.

 The saw contacted with the bone and it almost slipped off Feral's paws. Getting the

job done was going to be harder than he had expected. Felina grabbed the kat's

head with all her strength. Feral maneuvered the saw around the kat's skull,

trying to cut only the bone and not to damage the brain. The saw cut the top of

the kat's skull and Feral took it off like it was a lid. He tried to remember

his old high school days, when he did the same to a sheep in a Biology class.

With a bistoury in his gloved right paw he inserted it under the brain and

released it from the spinal medulla and the cranial nerves. Then, placing both

paws inside the skull, he took the brain out.

 "Get me the box," - he ordered his niece.

 She reached for a camping freezer. She took the lid off and Feral buried the

kat's brain under the sliced ice that was filling the freezer. She placed a name tag

near it and covered the freezer with its lid while Feral moved to the other kat.

She grabbed the kat's head again and Feral repeated the procedure, placing the

second brain inside the freezer, tagging and covering it too with the ice. He

turned to the bodies and zipped them inside the bags again.

 "Now what?" - Felina asked with a somewhat sick voice.

 She knew she was going to have nightmares for several nights because of this.

 "We gotta get rid of the bodies," - he said.

 He spotted the incinerator hatch further to the right. He opened and inspected

it. Fortunately, it was big enough for a kat to slide down it. He picked up one

of the kats and rested it in the hatch border before pushing it down.

 "I'm sorry..."

 Then, he pushed the black lump. He did the same with the other kat.

 "We gotta destroy their files too!" - Felina said.

 Feral just waved a huge paw in the air.  "Let Commander Feral take care of that. Right

now, we gotta get outta here.  'Lunch' time is almost over!"

 They left the 'pit' and headed for the service door. Feral was carrying the

freezer with the brains. They got out by the service door and headed for Feral's

off-road, which was parked in an alley two blocks away. Placing the freezer inside the

trunk, Feral drove out of the alley and joined the night traffic of Megakat City.

 They passed by the morgue on their way back to Headquarters. The pipe of the

incinerator was launching volleys of gray smoke into the dark skies along with

some flakes of fire. Feral slowed down as he passed by the front portico of the

morgue and closed his eyes for a second.

 "May the Holy Kats forgive our acts tonight."

 They drove back to Headquarters in utter silence.

------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------

 REBIRTHS

 »»» Present day «««

 "It's over now, Metallikats! You're surrounded!"

 Feral's grave tone echoed in the air in front of Megakat Savings, amplified and

slightly distorted by the loudspeaker.

 "Then, come and get us, Feral!" - Mac bellowed as he opened fire on an enforcer

car, blowing it up.

 "You asked for it, scum bag! LET 'EM HAVE IT!" - Feral ordered as he aimed his

own blaster at Mac.

 He hesitated for a moment.

 "Enforcer weapons should only be used to stun." - he thought, remembering the

rules.

 "The heck with it! You helped kill my son!"

 He regulated the power of his weapon to its limit, took a careful aim and shot.

 Mac fell instantly to the ground.

 Feral shot him in the shoulder but the blast was so great his whole right arm

was tore off his metal body. Molly saw it and made a true barrage of laser fire.

Feral aimed again, this time to Molly's head.

 He shot.

 In a split second decision, Mac jumped in front of Molly and used himself as a

shield. The blast caught him in his forehead and made him fall over Molly. Both

Metallikats fell on the ground.

 "GET THE SPARKS ON 'EM!" - Feral shouted.

 The nets were fired and covered both Metallikats, delivering a powerful

electric shock. Mac didn't offer resistance. The central processor in his head was

already fried by Feral's blast. Molly, on the other paw, fought back, but she couldn't

hold the continuous discharge and, eventually, her central processor was toasted as

well.

 "A job well done..." - Feral thought - "No casualties, no damage to the

buildings, nothing! Just a few scared kats and a burned out car. Nothing more."

 He headed for Sergeant Reeves.

 "Get 'em outta here!"

 Reeves saluted his commander with an emphatic 'Yes sir'. Feral went to his car

and drove off to HQ.

 "It's been already one year since you died, son... The Metallikats, however,

are alive... I wonder if the other creeps you and Clawson worked so hard to

eradicate from this city are alive too...

 If they are, then all your work and your death would have been in vain...

 But don't worry, son... I'll make them pay for it..."

 He arrived at HQ and headed directly to his office. He sat behind his desk and

his fingers flew over his PC's keyboard. He wanted to check his mail, like he

did ten times a day since his trip to the city morgue.

 He prayed to have the mail he wanted while the service was logging him on. Then,

the mailbox appeared. 'You have one message' it flickered. He clicked on it and

it appeared a few seconds later. It was part of a DNA strand.

          CAGCAATATAGATTTTTATGAGATTTCACAGACTTT

 "Yes!" - he whispered.

 He retrieved a sheet of paper and a pencil from a drawer and made two grids.

               TAGC           1234567890

               1234           ABCDEFGHIJ

               5678           KLMNOPQRST

               90             UVWXYZ

 "Now, if I remember what he said, I must replace T for A, A for T, G for C

and C for G."

 He did so and obtained the complementary DNA strand.

          GTCGTTATATCTAAAAATACTCTAAAGTGTCTGAAA

 "Now, I have to replace each letter for a number according to the first grid."

 He obtained several combinations, but he knew only one could be understood.

 "It must be this one! The triple 0 ending tells me that!"

          354315 05 65812000 052 4545000 3535 453000

 "Darn code! Now I have to replace each number for a letter according to the

second grid."

 He did so. Again, he obtained several combinations, but only one was readable.

 The message!

          CONWAY TO FERAL. JOB DONE. COME NOW.

 He sat back in his chair, staring at the sheet of paper.

 It was accomplished.

 The moment he waited for so long was now about to happen. He covered his face

with his huge paws and sighed.

 Could it be true?

 What if it was nothing more than a failed attempt like the last five? He

decided he wouldn't feed any hopes.

 But, the message seemed serious. Not like the others.

 Not 'I think we made it' or 'we believe it worked.'

 No.

 'Job done', that was what it said now. He took off his communicator and pressed

a button on it.

 "This is Commander Feral. Lieutenant Feral, do you copy?"

 The radio crackled once and her niece's voice filled his ear.

 "Lieutenant Feral here. Over."

 "Lieutenant, report to my office at once. Feral out," - he ordered her.

 The radio crackled again and her answer came.

 "Ten-four."

 Then, the radio went silent.

 Feral tore the paper apart, placed it in an ashtray and set it on fire.

-----------------------------------------------------------------------------------

 In a few minutes, Felina entered her uncle's office.

 "Lieutenant Feral reporting, sir."

 "At ease, Lieutenant." - he said, walking from behind his desk towards the

window.

 His face was just a few inches from the glass when his secretary announced over

the intercom that the Deputy Mayor had arrived. He went to the door and held it

open to allow Callie to enter in the office.

 "Sit down, please. Both."

 They did as they were told. He returned to his seat behind the desk. They

looked like students in front of the principal.

 Callie took the lead.  "Well, Commander? What is it?"

 "I gotta admit I'm curious too, uncle!" - Felina strengthened Callie's

question.

 Feral cleared his throat.

 "I've received the message we were waiting for," - he said in a calm tone.

 Both she-kats exchanged looks.

 "The job is done," - he completed.

 "You mean, this time's for real?" - Felina asked, verbalizing Callie's

questioning look.

 "Let's hope so. I don't need to remind you that this must remain between us.

*No one* should know what we've been doing during this year."

 He looked from one she-kat to the other.

 "We already swore to keep it a secret. As far as I'm concerned, nothing

happened during the past year!" - Callie said - "Shouldn't we get going?"

 "Let's go," - Feral said, rising from his chair.

 He held the door for both she-kats and then left, locking the door. They headed

downstairs to the Biotech Lab. Five enforcers were guarding the entrance. They

stood to attention as Feral and the two she-kats entered the lab. It'd been two

months since Feral stepped inside for the last time. Everything seemed the same,

almost like time hadn't passed in that place.

 "Ah, Commander Feral! Lieutenant Feral! Deputy Mayor Briggs!" - Dr. Conway

greeted the visitors - "Long time no see!"

 "How do you do Miss Feral, Miss Briggs, Feral?" - Prof. Hackle welcomed them

too.

 They returned the greeting to the two scientists.

 "Enough small talk, Conway." - Feral said - "Did you get it this time or

not?"

 The bearded tom-kat took off his glasses and cleaned them with his white lab

coat, putting them back on.

 "Well, Conway?" - Feral asked again, impatiently.

 "Let me show you."

 Dr. Conway took the group further inside the lab. What they saw gave them

chills.  In the far corner of the lab stood two large tubes with a translucent green

liquid.  Inside each one, was visible a full-grown kat-like form. They were both in

the fetal position.

 Feral approached, followed by Callie and Felina. One of the forms was burly and

the other was slimmer. They both had oxygen tubes attached to their nostrils.

 Feral touched the cylinder with the bulky form inside. It was warm. 37º

Celsius, Feral figured out.

 "Are... Are they alive?" - Feral asked. His tone betrayed his bewilderment.

 He looked to the face of the naked kat inside, floating slightly at his eyes'

level.

 "They're as alive as you or me, Commander," - Conway answered, adjusting his

glasses.

 Callie came to the other cylinder and looked at the slim kat. She could see his

muscular chest slowly rising and falling.

 "What is this green crud anyway?" - Felina asked.

 Dr. Conway seemed a little upset with her comment.

 "It's not crud, Lieutenant. It's amniotic fluid with a few extra nutrients that

give it its greenish color."

 "And, a little bit of motor oil, he, he," - Prof. Hackle said.

 They all spun their heads with an inquiring gaze.

 "Yes, motor oil. But not an ordinary oil. When they wake up we'll explain

everything. I'm sure they will be curious as well."

 They turned their attention to the kats again.

 "By the way..." - Callie said - "...when will that happen?"

 Suddenly, the slim kat twitched his tail slightly, which startled Callie.

 "It seems they'll wake up any minute now!" - Dr. Conway said as he headed for a

control console - "I think we should go to final procedure, Hackle, don't you

agree?"

 The aging kat nodded.

 Dr. Conway started draining the green liquid that held both kats. They slumped

to the floor of the tubes. Their eyes were still closed. Clean hot water began

showering from the top of the cylinders, cleaning both kats of the remains of the liquid.

 They opened the cylinders and, with the help of Feral and Felina, took the

soaked wet kats to two stainless steel stretchers. The scientists then dried their fur

and covered them both with white sheets.

 "They look just like the original ones!" - Callie said.

 "They *are* the original ones, Miss Briggs!" - Prof. Hackle said - "Feral did a

good job with the brains. They were physically undamaged. Of course, the lack of

oxygen had already ruined some neurons, but that was a minor setback. Nothing my

technology couldn't fix, at least."

 They heard the burly kat begin mumbling something unintelligibly.

 "They're waking up!"

 They all gathered around the kats.

 Suddenly, the burly tom-kat sat upright on the stretcher.

 "LOOK OUT!" - he screamed.

 Then, he blinked.

 Something was wrong.

 He wasn't in the courtroom anymore.

 By his side, the slim kat was awakening too. They looked around to get their

bearings.  Only then, did they notice they weren't alone.

 "Welcome back, SWAT Kats! We've been waiting a long time for you!" - Prof.

Hackle greeted them.

 Chance and Jake exchanged confused glances. They were totally lost.

 "Where are we?" - Chance asked.

 "How did we get here?" - Jake added.

 "And, why are we naked?" - Chance queried, peeping under the sheet and blushing

a bit.

 They all laughed.

 They were back, all right.

 Chance's good humor was evidence enough.

---------------------------------------------------------------------------------------

 "So we actually *died*?" - Jake asked from his standpoint near the window,

facing Dr. Conway.

 They were in Feral's office, already dressed up with some clothes Dr. Conway

gave them. Chance was right beside Jake, staring towards the salvage yard in

the distance. He still couldn't believe an entire year had passed since

the trial.

 His last memories from that day were blurred. All he remembered was getting up,

grabbing Jake by his waist and carrying him out of the courtroom.

 Then, he heard the detonations.

 And then, everything went black.

 He closed his eyes and shook his head, turning around to face the

orange-furred biotechnician.

 "You sure did!" - Dr. Conway said as he adjusted his glasses on his snout.

 "So... how come I don't remember anything?"

 "Quite simple, actually! Your brains simply ceased registering information

the moment they died!"

 "How did you bring us back to life?" - Chance queried, speaking for the

first time.

 A smirk appeared on both Dr. Conway's and Prof. Hackle's muzzles. This was

the moment they were waiting for, their moment of glory... when Science

overcomes the most basic laws of Nature...

 "It wasn't easy!" - Dr. Conway started - "As you might know it's virtually

impossible to... well... resurrect someone!"

 "However, modern day Technology and Biology can do miracles..." - Prof.

Hackle said.

 "And we combined them both!"

 "Have you ever heard the term 'technorganic'?" - the aging kat asked.

 Both kats shook their heads in a no after exchanging glances.

 "Well, let's start from the beginning." - Dr. Conway said as he leaned

back on his chair - "We had a problem. The SWAT Kats were dead and we

had to get them back in action right away. Time was something we didn't

have. We could have cloned you...

 "But then, you'd have had to raise us from embryos until we reached adulthood

and train us, meaning you'd have to sit up on your tails for, at least,

twenty years," - Chance stated.

 Dr. Conway simply nodded.

 "That's correct. We couldn't afford to lose so much time! Besides, the

yield of such a procedure is extremely low. As you might remember, the sheep

Dolly was successfully cloned after 400 attempts! From the implanted 277

embryos, 247 were recovered, from which only 29 were viable embryos and

only one developed into a fetus... You must admit that, with this procedure,

the odds were all against us...

 "So, you didn't clone us..."

 "We did something far more grand! We *recreated* your cells! Simply put,

you were reborn adults!"

 Jake and Chance exchanged confused looks. Dr. Conway hurried to explain

himself.

 "We simply designed your different cells. Although your bodies contain

millions of cells, they all fall in a bunch of major groups, such as

neuronal cells, muscle cells, lining cells, etc.

 A cell contains lots of organelles in its interior but basically, they all

look the same. We just encapsulated those organelles and rebuilt your bodies."

 "And, where did those organelles come from?" - Jake queried.

 "Good question! You have *our* organelles inside *your* cells.

We donated them to you."

 "But the DNA..." - Chance started, but Dr. Conway promptly raised a paw,

silencing him.

 "We removed the nuclear and mitochondrial DNA from our cells. It's really

simple to do it, you merely vacuum it with a micropipette. Your cells have

your DNA, which was retrieved from neurons in your brains. As a matter

of fact, your brains are everything you have left from your former bodies."

 "I still haven't figured out why Prof. Hackle was summoned to this job!

After all, his field's not Biology!" - Jake said.

 The aging kat leaned forward in his chair.

 "You're right, young kat. However, as Conway already said, we combined

Biology and Technology."

 "Precisely. Well, we still had a problem... In order to extract the organelles

from our cells, we had to disrupt the cell membrane, which posed a huge

problem... since the organelles had the same type of membrane coating their

interior..."

 "So, in order to keep the organelles undamaged, we decided to coat them with

nanochips before disrupting the cell membrane," - Prof. Hackle completed.

 Jake's jaw dropped in awe.

 "Nanochips?" - he repeated, dumbfounded.

 "Yes! Nanotechnology in its purest state!" - Prof. Hackle proudly stated

- "All your organelles and cell membranes are made of nanochips. We programmed

them to mimic the functions of your different kinds of fully differentiated

cells.

 Your red blood cells lack its nucleus, your fur cells are smooth and strong,

your taste buds have all the necessary nerve endings... you name it, you got

it! Your bodies are now what we've designated technorganic."

 "So... we're cyborgs? Like the Metallikats?" - Jake said in disgust.

 "*No*!" - Dr. Conway said, in shock - "You're normal kats! Everything in you is

natural! Well, everything except your membranes... but you can do everything a

normal kat does! You can even reproduce yourselves like a normal kat! Damn,

you're as normal as Commander Feral or the Deputy Mayor!"

 "Well... It really looks like real fur..." - Jake said as he stroked the fur

on his arm.

 "It *is* real fur! It was engineered to *be* real fur!" - Dr. Conway said

with a soft sigh.

 "There's something bugging me! Where are our former bodies?" - Chance asked.

 "They were destroyed after your brains were taken out," - Feral said,

hoping the big tabby wouldn't ask too many questions about it. "*Salvaged* is the

appropriate word..." - he turned around and stared outside the window again.

 "What about our identities? I mean, it'll be hard to explain why we were gone

for so long!" - he threw the question to the air, to no one in particular.

 Feral responded to the big tabby.

 "Your files in the morgue disappeared. As far as the world is concerned, you

never died. Your taxes are all paid and your duties were all filled in. For

all purposes, you were alive for the past year."

 Chance looked to Feral and then to Callie. He knew she had to have pulled many

strings to cover their death.

 She knew they were the SWAT Kats now. And, so did Conway and Hackle.

 Too many people. They were all in danger now.

 And, he had to protect them all.

------------------------------------------------------------------------------------------

 Felina drove Chance and Jake back to the salvage yard. The sun was setting

behind the buildings in Megakat City.

 Jake stared at them. It was so strange. Last time he saw it, the city was

shattered. Most skyscrapers were then scraping the ground.

 Now, a year later, most of them were rebuilt, scraping the sky again. Callie

must have really pressed the contractors to accomplish the job so swiftly.

 He climbed up a pile of metallic litter and sat on top of the hood of a car.

Chance joined him a little bit later. They both sat there in silence,

watching the red globe slowly sink in the horizon.

 "Where's Felina?" - Jake asked, keeping his eyes on the setting sun.

 "She left."

 They fell silent again until the sun hid completely behind the horizon.

Chance broke the silence.

 "I can't believe we actually..."

 "Died? Neither do I!"

 Jake rose from the hood and did a backward somersault, landing on his right

leg and keeping the left one retracted.

 "But, I couldn't do this anymore if my leg was still injured..."

 Chance got off the hood and opened it. He tried to lift the loosened

engine inside and tossed it to the next pile of litter with his left arm.

The engine smashed against the windshield of another car which stood ten

meters away.

 "I couldn't do that either if my lung still bothered me..."

 Chance closed the hood and they sat on top of it again, now looking at

the rising moon against the purple and blue sky. They followed the silver

planetoid with their gazes for some time.

 "You know what, Jake? It doesn't matter if we died or not. It doesn't matter

if all those crooks survived."

 He passed an arm over Jake's shoulders. Jake did the same. They stared at

the silver orb. Their eyes glistened as the opalescent light penetrated

into their pupils.

 "All that matters is... we're back!"

------------------------------------------------------------------------------------------

 His eyes flared as he returned to that hideous place.

 The infamy of that kat! Holding him in slavery!

 Well, it didn't work!

 He was free.

 He was free all along!

 Did he think he could *possibly* control him? With that *stupid* little serum?

 "Well think again, Dark Kat! Dr. Viper playsss sssecond fiddle to no one!"

 Viper was inside the volcano, former hideout of Dark Kat. He came out in

the lab the purple crime overlord prepared for him. Everything was in the

same position he left it. He headed for the big walk-in freezer.

 The green kat had been searching for the place for over a year but, thanks

to the countless passages inside the volcano, he only found it now.

But, the time spent in that search would finally start to pay off.

 He opened the walk-in sub-zero freezer. White vapor dropped in thin sheets on

the floor around Viper's feet. He instinctively raised one foot. Then, settled

it down and raised the other.

 Too cold.

 He sibilated. He had to go through with it. Now that he was so close, he

wouldn't let a little cold stop him.

 He stepped inside.

 Too cold. Too cold.

 The back of his mind was screaming for him to get away from the source of

that cold. But, he couldn't go back now. He was so close.

 So close.

 He opened a drawer and peered inside. There it was...

 The Erlenmeyer... Right where he hid it...

 He grabbed it and prepared to leave.

 Something stopped him. His feet. They were stuck to the ground. The ice glued

them.

 Too cold. Too cold. Too cold.

 He gathered all his strength and managed to rip one foot off the ground. Then,

he did the same with the other. Frozen scales marked the spot where he had stood.

 "Get outta here!" - his mind screamed.

 His muscles weren't responding fast enough. He awkwardly stepped to the door.

 "Almossst there! Jussst a few more stepsss!" - he muttered.

 He left the freezer and closed the big door. He then headed for the lab bench

and laid the beaker on it, panting. He growled.

 "Why the heck do I have ssso much hemoglobin in my blood if my mussscles

don't use it?" - he bawled. He was better now. The heat emanating from the

depths underneath him reanimated his frozen muscle fibers.

 "It'sss on occasionsss sssuch as thisss that I regret being a reptile...

 No matter...

 I already have what I've been looking for..." - he looked to the Erlenmeyer.

There was a frozen liquid inside.

 A blue frozen liquid.

 "It'sss not much, but it is enough to do what I have in mind. Now, where did

I put that map?"

 Carrying the Erlenmeyer and following the map he drew while he was exploring

the passages of the volcano in search of the lab, Viper quickly reached the

hangar built in the basalt rock.

 "Come out, come out, wherever you are, my little beassst!" - he whispered as

he inspected the hangar.

 There wasn't much light but his eyes were used to the darkness. He spotted the

cage far to his right, in the far corner of the hangar. He walked towards it.

 "Ssso that'sss where you're hiding!" - he hissed softly.

 The agrecite scorpion lunged towards Viper, screeching out loud. Only the

cage's bars prevented it from shredding the reptilian scientist. Viper

stepped back a little.

 "My, my, we're hungry aren't we? We should be after an entire year without

food..."

 The scorpion squeaked again, now in a lower tone. Viper took off a little

glass capsule with a diaphanous liquid inside from his lab coat and threw

it inside the cage. The capsule shattered and the liquid immediately

volatilized, creating a heavy gaseous atmosphere around the scorpion. The

huge orange beast blinked twice and then slumped to the ground.

 "But, for now, we'll jussst sssleep a little bit, okay?"

 With the help of the claw on his forefinger, Viper managed to unlock the

cage door. He headed for the scorpion and petted it. Then, he forced its

mouth to open and dropped some of the now liquid neurological serum inside.

He closed the scorpion's jaws and the beast swallowed the fluid.

 He waited until the combined effects of the sleeping gas and the serum

allowed the agrecite scorpion to slip out of its dormancy. The animal saw

him and didn't react. Viper called it and it came to him. The scorpion now

obeyed him. Both beings left the cavernous passages of the volcano and

headed back to Megakat Swamp.

------------------------------------------------------------------------------------------

 "'Morning, Jake!" - Chance greeted his friend as he stepped out of the

shower, wrapping a towel around his waist.

 Jake was brushing his fangs.  He spat the foamy gel and greeted him back.

 "Hiya! What's the matter? Fell out of the bed this morning?" - he said

before washing his mouth.

 He knew Chance liked to sleep in, especially on the weekends, which was

the case. Chance rubbed his fur with another towel.

 "Actually, I couldn't get a decent shut-eye last night."

 He put the second towel aside and started drying and combing his fur.

Jake stepped inside the shower area and turned on the cold water.

 "Why's that? Thinking about what happened to us?" - he said from inside

as he let the cold fluid run down his body.

 "That too."

 Jake was taken aback with that comment. He turned off the water and put

his head outside.

 "What else were you thinking about?"

 Chance turned off the dryer and dropped his head to his chest. His ears

dropped a little too.

 Jake mentally kicked himself. Of course. It could only be her.

 "I was thinking about Turmoil..." - Chance said mournfully as he

sat on a bench.

 Jake wrapped a towel around his waist and crouched in front of the

big tabby. He looked directly into his eyes. Chance turned his face

away from Jake's gaze.

 "She was really special to you, huh, buddy?"

 Chance closed his eyes. He didn't answer. He didn't have to. Jake knew it

perfectly from the month he and Turmoil spent together. If his love for

Turmoil was as great as the love she had for him, then Jake knew just how

special Turmoil was to Chance.

 "How was it, Jake?" - Chance suddenly asked, looking at his friend.

 "What?"

 "How was it between you and Turmoil when I was recovering from the crash?

We never did speak much about it, and..."

 "Just tell me what you want to know and I'll answer."

 "Did you ever..." - he hesitated - "Forget it..."

 "No, we didn't. She slept in your bed; I slept in mine. You know I wouldn't

do that to you, buddy."

 "I'm sorry... I didn't mean to insult you..." - he closed his eyes and

turned his face away from Jake's again.

 "Hey! It's okay! You didn't! Besides, you know my heart belongs to another

she-kat... Maybe you know that even better than I do!"

 "Tell me more about her." - a single teardrop raced down Chance's facial fur.

 - "I never met her outside the prison..." - Chance shook his head - "It's

weird... I loved her, but I didn't knew her..."

 "She was one amazing she-kat. A heck of a pilot, a golden heart, a good

friend... In one word, buddy... She was you..."

 Chance looked to Jake. It was a surreal picture! Two half naked tom-kats,

inside a bathroom, one damp, the other soaking wet talking about one's

deceased love. Chance swallowed his sadness and got up.

 "Well, guess that takes care of it. Go on - go take your bath."

 "Are you sure you're okay?"

 Chance coiled the towel he had put aside and whipped Jake's tail with it.

 "Go take your bath!" - he ordered with a giant smirk on his face.

 "HEY! I'm goin', I'm goin'!"

-------------------------------------------------------------------------------------

 "Chance, can I ask you something?" - Jake asked after he sipped some coffee.

 "Shoot!"

 "Well... I've been wanting to ask you this since our last meeting with Dark

Kat."

 He hesitated a bit. Chance noticed it, but just drank a bit of coffee from his

mug.

 "Where did you learn to fight like that? I mean, you never fought me like you

did with Dark Kat when we practiced here!"

 Chance smiled and closed his eyes. He couldn't believe it! Jake was jealous of

Dark Kat because Chance fought him in a way Jake would never dream of!

 What a fighting spirit Jake had... Fighting for the pleasure of fighting...

 The thrill of struggling against a new adversary...

 The honor and purity of unarmed combat...

 "Let's just say I had a good teacher," - Chance answered.

 "Who?"

 Chance's smile grew larger as he looked directly at Jake.

 "You," - he simply responded.

 "You're kidding me!" - Jake said as he stared at the big tabby - "I never

taught you anything!"

 "Just because you never guided my blows doesn't mean you haven't taught me."

 "Huh? Aw, come on, Chance! I asked you a straight question! I think I deserve

a straight answer, don't you?"

 "Okay, don't cough up a hairball for that! I studied you while you were

practicing. Those moves are yours."

 "But, it took me lots of time and practice to master them. You never spent

that much time in the dojo!"

 "You're right. But, I'm sure you noticed that I've spent much more time at my

'refuge' than I used to, didn't you?"

 "You practiced in the *desert*? Under that heat?"

 "You bet."

 "I'm not totally convinced... but I'll believe you. There's another thing

I'd like to know."

 "What, am I in a twenty questions game? Go ahead, shoot."

 "How did you mutate into that brawny colossus, anyway?"

 Chance just shrugged.

 "You got me, pal! All I know is that Dark Crud kept calling me envoy of

Horus, whatever that is. Feral mutated too and he called him envoy of

Amon... whatever that is too!"

 "Horus, Amon, Hel, Pluto, Hades, Seth... I know I heard those names before..."

- Jake said thoughtfully, rubbing his chin.

 "I know I heard Horus, Amon and Seth before, but the others... never heard

of 'em..." - Chance said as he finished his coffee - "So, do you want it or not?"

 "Want what?" - Jake queried with a confused look.

 "Fight me!"

 Jake's eyes nearly sparkled as a smile flourished on his muzzle.

 "O-oh, you bet, buddy! I can't hardly wait to fight you! C'mon! Time's

wasting!"

----------------------------------------------------------------------------------

 Viper gave a low sigh as he finally reached the swamps. He climbed up the

big mutated tree that housed his lab. The scorpion followed his every move

in blind compliance

 Once inside, Viper guided the huge beast to a separate compartment of his

living laboratory.

 "I'll be right back with some carcassesssssssss, okay?"

 He left the room and headed for the lab. He ordered his plantimals to hunt

down some animals and bring them to him.

 "I can't hardly wait for you to regain your full strength. Then, with a few

controlled mutationsss, we'll be *unssstoppable*!"

 "How thrilling! Bzzzzzzz!"

 Viper spun on his heel and snapped his tail in the air.

 "Who's there?" - he queried as his glowing eyes searched the room.

 He didn't see anyone. He looked up, towards the ceiling.

 Then, he saw it.

 He instinctively began salivating. Suddenly, he shook his head.

 No.

 He wouldn't let his reptilian instincts overcome his kat condition again.

Like he did when he shredded that blasted creepling. Though he couldn't

deny it felt *very* good...

 "Who are you?" - he asked as a few drops of saliva oozed through his teeth

and down his chin.

 "Don't you recognize me, Purvis?" - the sentence ended in a sharp buzzing

sound.

 "The name'sss Dr. Viper! Purvisss is dead!"

 The dark orange form dropped from the ceiling and landed on all fours on the

ground.

 "Don't you remember your old friend Street? Bzzzz."

 "Ssstreet? Harley Ssstreet? Is that you?"

 Dr. Street stood to his feet. He stepped forward, revealing his features. His

mouth parts clamped twice. His multifaceted green eyes captured thousands of

images of the green kat, one for each ommatidium, but his brain put the pieces

together and he saw only one detailed image. His membranous wings were fully

extended behind him. His arms were skinny as an insect's legs.

 "I thought the SSSWAT Kats had finished you off, Ssstreet," - Viper said, the

glow in his eyes fading a little.

 "I prefer Ci-kat-a, Viper, if you don't mind!" - he made some more buzzing

sounds before he could speak again.

 "What do you want from here?" - Viper shot.

 "From here, nothing. From you, that's a different matter. Bzzz-zzzz! I'm

offering you an alliance in the name of our old friendship."

 "Oh, no! Not again!" - Viper thought - "What do these creepsss take me for?

A fool? Sssomeone who can't win by hisss own meansss?"

 "I'm not interesssted! Now leave!" - he said, turning away from the

mutated bug-kat.

 "You can study me..." - he buzzed teasingly.

 Viper stopped. Ci-kat-a had pressed the right button, his weak spot.

 His scientific curiosity.

 He couldn't let the opportunity of studying an alien bug slip through his

fingers.

 "Okay, you have my attention. What do you want?"

 "I want the ability to breed."

 Viper cocked one eyebrow. A mocking grin appeared on his snout.

 "You want to change your sexsssssssss?"

 "Moron... You know perfectly well it's not that. The original Ci-kat-a could

reproduce itself whenever it wanted. I want to do the same."

 "What for? - As if I didn't know..." - he muttered the last sentence to

himself.

 "I want to produce an *army* of ci-kat-as so I can defeat those infernal SWAT

Kats and turn this city into a giant hive for my kind, from where we'll conquer

this planet!" - he made a final buzzing sound that seemed like laughter.

 "And jussst what would be my plassse in that bug-ruled world?" - Viper asked

suspiciously.

 "You can rule by my side. After all, if I manage to conquer this world it'll

be because of you!" - he buzzed.

 Viper thought for a moment.

 "Are you a kat or an insssect?"

 "Why the question?"

 "To know jussst how hard my tasssk will be. We have a deal."

-----------------------------------------------------------------------------------------

 Chance slumped to the ground in the arena with his arms spread out wide. He was

exhausted, his fur soaked with sweat, his bare chest lifting and abating

rapidly, his mouth wide open, trying to soak up all the air he could, his abdominal

muscles relaxing and contracting with each breath he took.

 Four hours fighting...

 Running, punching, missing, blocking, kicking, flipping, getting hit,

somersaulting, dodging, hitting...

 For four hours...

 And, Jake still wanted more...

 He came to the big kat, crouched beside him and tapped him on the shoulder.

 "Don't tell me you're givin' up already?"

 Jake's fur on his bare torso was damp with perspiration too and he panted

like an old kat, but he seemed tireless. His muzzle had a jovial smile and

his eyes were nearly sparkling.

 Chance looked at his partner in amazement.

 "Don't... Don't you get... tired?" - Chance managed to say between pants.

 "Tired of what? This was just a warm-up!" - Jake said, his smile growing

larger.

 Chance widened his eyes and opened his mouth. He couldn't believe it! A

warm-up? Then, he hadn't even started to fight seriously yet?

 Jake noticed his friend's astonished look and began laughing.

 "What's... so funny?"

 "You! Did you really think all of this was just a warm-up exercise? Of

course I'm tired! But, I'm happy as well! I never fought someone like you

before! C'mon, let's start it again!"

 "Jake, you're a monster! I surrender! I'm not moving from here! Kill me

if you want but, I'm not moving from here!"

 Jake's smile instantly disappeared from his snout. He got up and left the

arena, grabbing a towel on his way out. Chance heaved his bulk from the

ground and ran to Jake.

 "Jake, what happened?" - he asked, concern spreading inside his chest.

 Jake just closed his eyes and dropped his head to his chest. Chance couldn't

understand. His nightmare returned as vividly as when he first dreamt it.

 "What's going on, buddy? Speak to me! C'mon, you're making me feel miserable!

Was it something I said?" - Chance asked while he stopped Jake by settling

his bulk in front of him.

 Jake heaved out a sigh.

 "I'm sorry... Your words made me remember a nightmare I had when you were

out..."

 "Do you want to talk about it?"

 Jake shook his head no. Then, he gave Chance his earnest face.

 "Chance, promise me you won't let me kill you! Promise me you'll finish me off

first if I ever threaten your life!"

 "What're you talking about?" - Chance asked in shock.

 "*Promise me*! Please!"

 "No! I won't!" - Chance said as he grabbed Jake's shoulders tightly and threw

him his most intense gaze.

 Jake looked to his partner with humid eyes. He knew he couldn't understand

his dreams.

 "I'll *never* kill you! And, I know you won't kill me too!" - Chance reassured

him.

 "How I wish that were true..." - Jake thought, dropping his head and closing

his eyes again.

 "Is everything okay with you, Jake?"

 "Yeah... I guess I shouldn't let my nightmares command my life..." - he sighed.

 "No matter how horrific they may seem, Jake, dreams are just what they are...

Dreams... And, nothing more than that..."

---------------------------------------------------------------------------------------

 "Darn!" - Viper hissed furiously, waving his tail in the air. Ci-kat-a looked

at him from the vine-made stretcher with the inquiring gaze a bug's face could

show.

 "What is it?"

 "Let me get this ssstraight in my head... You sssay you want to breed without

mating, right?"

 Ci-kat-a nodded.

 "But, you can't do it, right?"

 The mutated bug-kat nodded again.

 "Ssso you're dioeciousssssss..."

 "I'm *what*?"

 "You're an organism that can only produssse one type of gametesss. In your

case, male gametesss. In order to be able to ssself-breed you mussst be monoeciousss,

that is, you mussst be able to produssse both male and female gametesss. If you

were an insssect or a frog or even a reptile that would be easy..."

 "But..."

 "But you're ssstill a darn mammal... You're ssstill a kat! You're just a

mutant!"

 "So, what's your point?"

 "My point isssssss - though you may have a few insssect traitssssss, like your

eyesss, mouth partsss, wingsss, ssstrength and resistanssse, your reproductive

sssystem is ssstill mammal-like!"

 "Meaning?"

 Viper sighed and hissed in frustration.

 "It meansss I'm going to have to make a messsss out of my lab if I want to turn

you monoecioussssssss! And yesss, it won't be pleasant..."

 "But it can be done..."

 "Obviousssly..." - he stared around his green and brown lab and then sighed

- "I jussst hope the red ssspots won't ruin my decoration..."

-------------------------------------------------------------------------------------

 "How's it lookin', partner?" - Chance asked Jake.

 They stood in the hangar, where pieces of the TurboKat lay in the middle of

the vast room. They managed to salvage the jet's remains from its organic pyre

near the Dark Pyramid and deposited them in their hangar but their sudden death

prevented them from rebuilding the black jet. Now, the metallic carcass was

somewhat rusty.

 "Not good but still, not too bad... A couple o' weeks work, at least...

The ABA mega-alloy protected the engines and most of the frame, but still..."

 Jake sighed. He had another partially melted black, twisted monstrosity in front

of him to fix. Chance petted the remains of the jet.

 "So banged up... My little beloved..." - he turned to Jake - "Let's start doing

it... I can't stand to see her like that..."

 Jake nodded. They both left the hangar and went outside to look for some pieces

they could use to rebuild the black fighter jet.

 "You know, last time I did this, Turmoil and..."

 Jake mentally whipped his tail. He didn't want to talk about Turmoil near

Chance.  He looked to the big tabby, but he didn't seem sad.

 "You were saying, bud?"

 "I... was saying... last time I searched for components for the TurboKat,

Turmoil and I were mad at Dark Kat," - Jake said in a tentative tone.

 "Really? I wonder why?"

 Chance gave Jake his trademark smirk.

 Jake was surprised. That morning Chance nearly cried when he spoke of Turmoil

and now...

 No...

 He was hiding it... He was hiding his feelings from him, like he always did...

 "Like *I* always did with him too..." - he thought - "Chance, Chance... We've

been friends for so long now and we barely know each other. I don't know anything

about your past, just as you don't know anything about mine...

 And, does it really matter?

 Not for me... All that matters is that we have our friendship... Now and

forever..."

------------------------------------------------------------------------------------

 A week had elapsed. Jake and Chance embraced their mechanics life again. Their

days were filled repairing cars and/or the TurboKat. As Burke and Murray were

reassigned to another town shortly after their death, they never saw the two punks

anymore.

 Viper continued his research on Ci-kat-a. He was amazed. The bug-kat was much

more fascinating than his previous exams had told him! And his self-preservation

capabilities were outstanding! Even completely torn open, the mutated kat still

lived. Unconscious, but alive.

 Finally, the work was done. Viper sutured the incisions he made on the somewhat

chitinous skin of Ci-kat-a with precise stitches. When he finished, the bug-kat

started to move.

 "Incredible!" - Viper thought - "He felt when his body wasn't at ssstake

anymore!"

 "Is it done?" - Ci-kat-a asked in a groggy voice.

 "It is! I wouldn't move for a while if I were you. I just sssutured you."

 "When will I be able to breed?"

 Viper narrowed his eyes and grinned.

 "Right now if you want to..."

 Ci-kat-a lifted from the vine stretcher and stood on the ground on all fours,

raising his wings. He extended and lowered his ovipositor, which shuddered a

little and then a white ellipsoidal form the size of a basketball slowly

squeezed through the opening. He lowered the ovipositor a little more so

that the egg contacted the floor. The egg came out with a bunch of a translucent,

sticky slime, which steadied the egg on the ground.

 "Aw, damn, did you have to do that *here*?" - Viper moaned - "Thisss is

*really* gonna ruin my decoration..."

 "It hurts a bit... It's strange... The feeling of generating a new life... It

gives you a feeling of power... As if you were a *god* or something..."

 "Uh-ho!" - Viper thought - "Thisss is not a good ssstart... If he ssstarts

thinking he's divine, then we're really in big trouble... Guesssssss I'll

have to kill him sssooner than I thought... But only *after* he has dessstroyed

the SSSWAT Kats..."

 "Thank you, Viper! I won't forget what you did for me... You can keep the egg.

I'll have to find a new hive for my brood now!"

 Then, the bug-kat went out of Viper's lab.

 Viper's eyes glowed and a sinister grin appeared in his snout.

 "I know you won't forget what I did for you... My... sssurgery... will take

care of that..."

 He then stared at the whitish ellipsoid surrounded by a pool of slime in the

middle of the room.

 "If only it didn't have all this sssticky, sssmelly *goo*..." - he began

salivating - "Well, guessss I can make a big omelet with it..."

----------------------------------------------------------------------------------

 Callie got up early as she always did on Mondays. She could imagine the amount

of paperwork she would have on top of her desk right now. Mondays and Fridays,

those were her nemesis.

 She yawned as she stepped inside the lift. It was so early that even the

cleaning crew hadn't departed yet. The elevator took her to the last floor,

where her and Manx offices were. When she stepped out of the lift several

whitish soft ellipsoids tumbled to her feet. She made a disgusted face as the

translucent slime dropped on her feet.

 "Eeew! What *is* this thing?"

 She covered her nose with her paw as the pungent odor of the slime filled

the tiny space of the elevator. She left the elevator and gasped in horror.

The entire floor of the corridor was filled with those soft things. And, the

smell was unbearable. Fighting her disgust, she made her way through the

whitish objects and went up to the roof.

 She opened the door to the clock house and gasped as a small avalanche of

those whitish things fell over her, dragging her as it rushed downstairs.

Her clothes were all covered with sticky slime.

 "This is *gross*! Yach! What *are* these things anyway? They remind me of..."

 A chill ran down her spine.

 They reminded her of insect's eggs!

 She forced herself to take a closer look. She touched one egg. It was soft and

cold. She could see something moving inside. She peered closer. The eggshell

was whitish but somewhat translucent. The thing inside was bent over itself

and seemed to have a purple color.

 Then, it suddenly looked directly at her with its big red multifaceted eyes.

 She pulled her head back, frightened, and dropped the egg.

 The egg began trembling. It suddenly lost its whitish color. It was now

transparent. The bug inside started squirming and biting the eggshell. All

around her, several other eggs lost their color too and the insects inside

were squirming and eating the eggshell.

 Callie turned on her heel and ran downstairs, knocking and tumbling the

eggs in her way. She reached the elevator and slammed the button. Fortunately,

no one had called it and it was still up there. She ran inside and slammed her

finger on the 'down' button.

 She was quivering from head to toe. The translucent smelly goo ran down her

features and her clothes. When she recovered enough from her shock, she reached

inside her purse and retrieved a white triangular object with a red circle in

the center. She pressed the button in the center with such force it seemed her

finger would be stuck on it.

-----------------------------------------------------------------------------------

 Jake and Chance were repairing the TurboKat when the klaxon and the red light

beside it filled the hangar with fiery red blasts and loud honking sounds.

 "Action, finally!" - Chance said as he ran to pick up the receiver.

- "Yes, Miss Briggs!"

 "Chance, am I glad to hear you..." - she said with an urgent but relieved

tone in her voice. She suddenly covered her mouth with her paw.

 "I'm sorry, I forgot I shouldn't use your real names!"

 "Never mind that, Callie! What's happening? You seem startled!"

- he asked, concerned.

 "We have a little bug problem at City Hall, guys. It's the ci-kat-a!

It's back!"

 "WHAT? But, I thought we squished that termite!" - he said, his own

voice shuddering a little.

 "All I know is that the upper floors of City Hall are infested with these

hideous eggs... Oh! Oh, no! It's getting out! AAAAAAAAAAHHHH!"

 "CALLIE! CALLIE, ARE YOU THERE?"

 Nothing. The receiver went blank after a few moments of static. Jake ran to his

side with an inquiring and worried gaze.

 "What happened? Is Callie in trouble?"

 "I think so, buddy! I never heard her so frightened! It's that ci-kat-a

again!" - Chance said as he put the receiver back on the hook.

 Both kats ran to their lockers.

 "I thought we finished it off!" - Jake said as he put on his G-suit.

 "Jake, I think you'd better stay here and finish with the TurboKat!"

 "No way! I'm goin' with you!"

 Chance stopped him.

 "Jake, think! We might need the TurboKat ready! Of us both you're the one

more qualified for that job!"

 "But, Callie..."

 Chance grabbed Jake's shoulder and squeezed it a bit.

 "Don't worry! I'll save her! I *promise*!" - Chance said reassuringly.

 Jake seemed to power down a little.

 "What about you? Are you sure you can handle that bug?" - he asked, remembering

Chance's entomophobia.

 "I'm not afraid of bugs anymore! I thought I made that perfectly clear

already!"

 "Okay..." - Jake reluctantly said - "But, maintain radio contact at all times,

do you hear? Leave the frequency open!"

 "Affirmative!" - T-Bone said as he put on his helmet and clicked on its side

to activate the radio.

 He ran to the Cyclotron and left the hangar. Razor activated his radio too

and tested it.

 "T-Bone, do you copy?"

 "Loud and clear!"

 "Okay, Razor out!" - he closed his eyes and thought to himself - "Save her,

T-Bone... Please, save her..."

-----------------------------------------------------------------------------------

 T-Bone drove the Cyclotron toward Megakat City. He was sunk in his own

thoughts.

 "Cru-ud! Why did they have to be bugs again? I'm not so scared of bugs like

I used to be but still... Crud, this is *not* my idea of fun!"

 He joined the morning traffic of Megakat City. Fortunately, it was early and

the traffic wasn't dense yet. He managed to reach City Hall in a few minutes.

 The few workers that were already in there watched in astonishment as T-Bone

burst through the front doors and drove the Cyclotron inside the building and

upstairs. He stopped the Cyclotron when he reached the last floor. Besides some

smelly translucent ooze on the carpet, there was nothing there.

 "T-Bone, what's going on?" - his radio crackled.

 "I'm on the top floor heading for the clock tower. So far so good, but there's

still no sign of Callie."

 "Roger. Be careful! Razor out."

 "Ain't I always?" - he muttered and grinned.

 The smell was getting stronger. He left the Cyclotron and slid his glovatrix

on his right arm. He leaned against the wall when he reached the corner and

peered. Nothing. The corridors were empty.

 But, the smell remained. Stinky. Like rotten flesh.

 He headed for the clock house. The stench was getting stronger by the moment.

He opened the door and gasped at what he saw.

 A hive. Filled with dozens and dozens of eggs. And, a few purple bugs, flying

around with their red wings.

 "What is it?" - Razor's voice came from the radio. He had heard T-Bone's gasp.

 "It's... It's a hive..." - he whispered - "I'll try to sneak in!"

 "Be careful!"

 "I heard that the first time, okay?"

 T-Bone closed the door and hid behind a structure similar to a honeycomb.

There was one egg inside each hole.

 Then, he saw her. A chill ran down his spine when he saw Callie stuck to

another honeycomb with a sticky yellow slime. She seemed unconscious but

unharmed.

 T-Bone scanned the hive. He hadn't located the big bug yet.

 "That's odd... With so many eggs, the progenitor shouldn't be far away!"

- he mumbled.

 He tried to count the flying bugs. Nine, it seemed. He knew those bugs could

put up a good fight. And, he didn't want to get bitten by any of them.

 "Guess my only choice is to snipe 'em," - he thought.

 He aimed his glovatrix carefully. From his standpoint, he could only get a

clear shot when the bugs weren't moving.

 "There you go, baby! Just like shooting ducks in a carnival..."

 He fired a Mini Turbo-Blade which beheaded the little ci-kat-a. The bug fell

limply to the ground with a low thud.

 "Gotcha... One down, eight to go..."

 He managed to shoot down five more ci-kat-as before he was spotted.

 "CRUD!"

 The purple bugs plummeted down on him. He left his hiding place and jumped

forward, rolling on his back and standing to his feet. The ci-kat-as didn't

maneuver rapidly enough and smacked against the honeycomb.

 T-Bone fired three Mini Spider Missiles, which wrapped two of the ci-kat-as in

their threads. The third bug flew towards him and tackled him, knocking the big

tabby to the ground. The bug tried to bite him. His black mouth parts snapped

wildly near T-Bone's neck. He managed to keep them away from him.

 "Chew on this, slime ball!"

 He fired a Mini Turboblade directly into the mouth of the ci-kat-a. The sharp

piece of metal ripped the bug's head and left by the back of its skull. The

dying bug let out a volley of yellow ooze over T-Bone's face. He tossed the

bug away and quickly wiped the sticky, smelly slime off his face.

 "Dirt bag! Crud, this *stinks*!" - T-Bone said, grimacing in disgust.

 "T-Bone, come in! Do you copy? T-Bone!"

 "I'm here, Razor. Everything's fine. I've spotted Callie and I'm taking

her out of here."

 "How is she, pal?"

 "She's fine!" - he went to the honeycomb where Callie stood - "I hope!"

- he muttered.

 He climbed up the honeycomb and took away part of the yellow mucus. She fell a

little and he grabbed her, jumping to the ground.

 "Now, let's clean this crud from City Hall! Deploy Mini Match-Head Missiles!"

 The missiles set the hive on fire. T-Bone got out of the clock tower and ran

downstairs, towards the Cyclotron. Callie was regaining consciousness.

 "Wha... What happened? Where am I?" - she babbled.

 "You're safe now, Miss Briggs."

 "T-Bone? The bugs... They're..."

 "Everything's okay, Miss Briggs." - he slammed his fist on the fire alarm and

the bells started ringing all over the building.

 "Where's the fire?" - she asked. She had a confused look on her face.

 "Right above us!"

 Just when he finished the sentence, there was a blast.

 "CRUD! Guess that slime was explosive too!"

 A rush of fire was descending after them, burning everything it touched.

He slipped onto the Cyclotron and motioned Callie to sit in front of him.

 "Keep your head down, Miss Briggs! We're gonna use the emergency exit!"

 He started the Cyclotron and rushed towards the window at the end of the

corridor. The wall of fire was just behind them.

 "What emergency exit? No! You don't mean..."

 She ducked her head and he leaned his torso over her back. He ducked his

head too when they crashed through the window and began falling from the top

floor of City Hall.

 "Emergency thrusters... ON!"

 He slammed his hand on a button and the thrusters roared to life, boosting

the Cyclotron over the void between City Hall and the neighboring building.

The roaring blast of fire rushed over T-Bone's back but only slightly burned

his G-suit.

 The Cyclotron landed on the roof of a nearby building with its rear wheel.

T-Bone controlled the red transport and halted it. He raised his torso and

peered down to Callie.

 "Miss Briggs, are you okay?"

 She got up and looked behind. She nodded her head yes. They both looked back

at City Hall. The clock tower was on fire, but the firekats were already on

their way.

 "I hope we've seen the last of those bugs!" - she said as she climbed out

of the Cyclotron - "Oh, this is disgusting! My clothes are all *gooey*! Yach!"

 "YOU DID THIS TO MY HIVE, SWAT KAT! NOW, YOU MUST PAY FOR IT WITH

YOUR LIFE!"

- a voice buzzed from above them.

 A  dark orange form fell on top of T-Bone, knocking him to the roof.

T-Bone hit the roof on his face.

 Callie stepped away a little bit.

 Ci-kat-a grabbed T-Bone by his shoulder harness and tossed him against a

ventilation unit.

 The big tabby collapsed to the ground, where he stood on all fours, shaking his

head. He looked up and a thin thread of blood dripped from his nostrils. He

licked the red fluid from his upper lip and spat it.

 "So, the big bug can talk too!" - he said as he stood to his feet - "That's a

new development! And, I thought ci-kat-as only came in purple..."

 "I was Dr. Harley Street, but now you can call me Ci-kat-a!"

 He lunged at T-Bone but the kat dodged the bug-kat and smashed his fists on

Ci-kat-a's back, making him crash to the floor.

 "Dr. Bug-Eyes! Now *that's* a surprise! I thought we'd finished you off

years ago!" - he teased the mutated kat as the other threw him a punch, which

the big tabby blocked perfectly.

 He punched Ci-kat-a  in the face, but the bug-kat jumped on top of T-Bone,

knocking him to the ground.

 "Just one bite and you'll be on my side, helping me to conquer this puny

world!" - Ci-kat-a said as his black mouth parts drew closer to T-Bone's neck.

 "Bite the floor, you sicko!"

 The strength of the mutated kat was considerable, but T-Bone was more agile. He

placed one foot in Ci-kat-a's gut and tossed him over his head. The bug-kat

smashed to the ground behind the big tabby.

 "You heard that, Razor? Dr. Bug-Eyes is back!"

 "Give him a punch for me, will you, buddy!" - Razor's voice came from the radio.

 "My pleasure!" - he purred.

 Ci-kat-ta got to his feet and flew over T-Bone, spitting some yellow slime

over him.

 T-Bone just barely dodged the first volley when he was hit in the chest by

a second one.

 "Ah, *nuts*! I just washed the suit! Eat this!"

 T-Bone fired a Mini Octopus Missile that clamped Ci-kat-a's jaws together. However,

he tore it apart just by opening his mouth parts. He spat some more ooze,

but T-Bone escaped from the shots.

 The bug-kat plummeted down on him and punched him in the face, making the

big kat fall to the ground. He then landed on top of T-Bone and vomited a

large quantity of slime, almost encapsulating the big tabby inside. The

slime slowed down his movements. The more he fought it, the more it stuck

to his body. Ci-kat-a slowly leaned over T-Bone, ready to bite him.

 The big kat was defenseless.

 The wicked jaws got closer and closer to his neck.

 He could feel the stinking breath of the mutated kat slightly waving his

neck's fur.

 He fought with all his strength but only got even more entangled in the

sticky slime.

 But then, something happened.

 Ci-kat-a arched his back and braced his abdomen, screeching out loud. He

stepped back from T-Bone, still embracing himself and screaming in pain.

He fell to his knees.

 Callie ran to the big tabby and helped removed the yellow crud from him.

 "What's got into him?" - she asked in shock.

 "Beats me, but I'm gonna get rid of him right now!" - T-Bone said as he

rose from the ground and ran towards the bug-kat.

 Ci-kat-a saw the SWAT Kat running to him. He knew he couldn't fight him with

that pain inside him. He had to get away. Away from there. Away from him.

 "Viper... I don't know how, but I'm sure you're behind this..." - he mumbled.

He extended his membranous wings and flew off the building.

 "CRUD! You won't get away from me that easy!"

 T-Bone threw a tiny tracking device that attached to Ci-kat-a's fur. He

climbed up the Cyclotron and jumped from building to building until he

hit the ground level.

 "Razor, you have him?"

 "Affirmative! Signal's coming in strong, T-Bone!"

 "Good! Don't lose him! I think I may have a few problems; it's rush hour."

 "Don't worry. Hey! That's odd!"

 "What's up?

 "He seems to be heading for... Megakat Swamp?" - Razor said. Even over

the radio his voice seemed puzzled.

 "The swamps? Shouldn't he be heading for the MASA Space Center or the

nuclear plant or something?"

 "No... He's definitely going for the swamps..."

 "Okay, buddy. I'm on my way."

 A few seconds passed before Razor spoke again.

 "T-Bone, how's Callie?" - he asked sheepishly.

 "She's fine, buddy, don't worry! Hey, I told you I'd save her, didn't I?"

------------------------------------------------------------------------------------------

 "Aaahh! Sssequencing DNA is one of the sssimple pleasuresss in life..."

- Viper sighed happily as he prepared a gel electrophoresis for the DNA

sample he had retrieved from the agrecite scorpion.

 "VIPER!" - Ci-kat-a roared as he burst inside Viper's lab.

 In his right paw there was a sap slinger hanging limply and slobbering

green acidic sap onto the ground.

 Viper turned to see his dead plantimal hanging in the paw of the bug-kat.

His eyes glowed bright golden as a grin appeared on his snout.

 "Ssso... You're back! What do you want from me thisss time?"

 "You slimy piece of crud! You know *exactly* why I'm here!" - he said as

he tossed the plantimal against the wall, squashing it and leaving a green

burst of sap on the dull wall.

 "You really should ssstop messsssssing around with my decoration, you know?"

 Ci-kat-a leapt into the air and lunged towards Viper.

 The green kat promptly snaked his tail around the bug-kat's neck, tightening

the grip. The bug-kat tried to bite Viper's tail, but the good doctor wasn't a

fool. He knew Ci-kat-a's jaws couldn't bite him the way he had grabbed the bug-kat.

 "Now, if we jussst calm down a little bit maybe we can sssettle thisss, *okay*?"

 Viper tightened his grip around Ci-kat-a's throat even more. The bug-kat

couldn't do much more than buzz in reply. Viper loosened the grip but kept

his tail around the bug-kat's neck.

 "Okay..."

 "Very well. Now, I sssuppose you're here because of a sssertain pain, aren't

you?"

 Ci-kat-a began squirming furiously again and spat some yellow slime toward

Viper's face.

 The reptilian scientist tightened the grip of his tail around the bug-kat's

neck so hard he nearly broke his trachea.

 Ci-kat-a calmed down again.

 "Don't you *ever* do that again!" - Viper said as he swept the crud away from his

face with his paws.

 "What did you do to me?"

 Viper chuckled dryly. He went to the lab bench with the bug-kat still entwined

in the powerful hug of his tail and retrieved a test tube with a whitish liquid

in it. He showed it to the bug-kat.

 "Know what thisss isss? It'sss sssomething you lack in your syssstem. You

sssee, when I was operating on you I couldn't help to make a few... modificationsss...

on your genome. It'sss quite easy, really! With the proper mutagenic chemicals, I

made your DNA mutate and ssso, your cellsss can't produssse the aminoasssid

methyonine anymore."

 He placed the test tube on its support again. Then, he turned his gaze to

Ci-kat-a.

 "Unlesssss you're completely sssupplied with methyonine by me, you'll sssoon

ssslip into a coma and die."

 "Why did you betray me?"

 "Weren't you planning to do the sssame with me?"

 Ci-kat-a didn't answer. Viper grinned. He was still the same Harley Street

that Purvis had known from their university days.

 "I need that thing! I feel like I'm falling apart!" - Ci-kat-a asked.

 Viper just gave a little dry chuckle as he retrieved the test tube again.

 "That'sss one of the symptomsss, alright! Here, drink thisss. It will enter

into your sssystem as soon as your digessstive tract begins absssorbing it,

which should happen in a few minutessss."

 Viper released Ci-kat-a and handed him the test tube. The bug-kat grabbed it

and awkwardly drank the whitish liquid.

 "So, I guess now I'm under your control, huh?" - Ci-kat-a sighed resignedly

- "What do you want from me?"

 "I want to mutate you! You're already part ssspace insssect. With my

mutationsss, I can turn you into an unssstoppable weapon! Imagine what I could

accomplish with a ssservant who could reprodussse like you can!" - he said, eyes

glowing, tail slashing the air crazily behind him.

 "You're insane!"

 "I know..."

---------------------------------------------------------------------------------------

 T-Bone finally got rid of the rush hour traffic and sped up the freeway that

took him out of the city and passed near the swamps. He twitched his nose. He

smelled like rotten flesh. But, there wasn't time to think about it. He had to

find the ci-kat-a and destroy it before it could reproduce again. But then

again, the bug must be starved. So, why didn't he go to the nuclear plant to

feed on some nuclear fuel rods like his predecessor did? Why did he go to the

swamps instead? His thoughts were interrupted when Razor's voice crackled over

the radio.

 "Hey partner, how's it goin'?"

 "I'm on the freeway, heading for the swamps. I should get there in half an

hour!"

 "Need a ride?" - the voice seemed amused.

 T-Bone looked behind him. There it was, like a huge dark bird of prey.

The TurboKat.

 "You fixed her already?" - he asked dumbfounded.

 "Almost! She needs some more fine tuning but hey, she can fly! Get ready!

I'll pick you up in T minus five."

 "Ready for pick-up in three... two... one..."

 The TurboKat made a grazing pass over the red transport and picked it up in

its cargo bay. T-Bone appeared in the unfamiliar rear seat of the black jet.

Razor flew the jet fighter up and towards the swamps.

 "Nice catch, Razor!" - T-Bone said as he strapped in.

 "You're not the only one who's been spying around, you know?" - Razor said

with a smirk on his muzzle.

 "Why you little... Okay, I guess it's fair..."

 "You got him on radar?"

 T-Bone didn't answer immediately. It took him a bit to familiarize himself with

the instruments in front of him.

 "Got it! His signal's comin' due... southwest. Right in the middle of the

swamps!"

 "Next stop... Megakat Swamp." - Razor said as he pushed the throttle switch

forward. He twitched his nose and grimaced in disgust.

 "What *is* that smell?"

 "Don't ask..."

 "Pee-yew! Buddy, you *stink*!"

 "Tell me somethin' I don't already know! Yach! I'm all *slimy*!"

 "Aw, crud... I just cleaned the cabin..."

------------------------------------------------------------------------------

 "How are you feeling now?" - Viper asked the bug-kat.

 He was surprised that Ci-kat-a accepted his servant condition so promptly,

without ever arguing or trying to bite him or kill him. The bug-kat's

attitude made him cautious. But, on the other paw, he knew Ci-kat-a couldn't

survive without him.

 "Much better. That pain was awful, Viper! It was as if my body was slowly

disintegrating!"

 "You manage to do a correct dessscription of what wasss actually happening

inside your body without having the proper knowledge for it... It'sss amazing!

Yesss, your body *wasss* disssintegrating. Without that aminoasssid, your

cellssss can't produce proteinsss, which are the building blocksss of your

body..."

 "So I really *was* coming apart!"

 "Quite literally... Wait a minute... What'sss thissssssss?"

 Viper took out a little, round-shaped white device from the fur on Ci-kat-a's

back. There were two initials on it.

 "S K? YOU FOOL! YOU LED THE SSSWAT KATSSS RIGHT TO MY LAB!" - Viper

shouted as

he threw the tiny device on the floor and crushed it with his foot. He calmed

down a little bit, forcing himself to think rationally.

 "Well, let them come. When they arrive here, they will have a little

sssurprise!  We'll crush them like *flyessssss*! Hum, no offenssse..."

---------------------------------------------------------------------------------------

 "Kat Tracker's got him!" - Razor said as he inspected the triangular display

on his glovatrix - "Dr. Bug-Eyes should be dead ahead!"

 "I just hope we don't tumble with Dr. Viper... We're on his ground now..."

- T-Bone said as he walked through the swamp near the marshes.

 "Hey! Where did he go?" - Razor asked to himself.

 "What's up?"

 "I lost him!"

 "He must have found the beacon... WHOA!"

 T-Bone slipped on something and plunged in the muddy water. He promptly burst

up, gasping for air and started floating.

 "'Re you okay?" - Razor asked as he swam towards the big tabby.

 "I'm fine! You already taught me to swim, remember?" - T-Bone said as he swam

towards Razor.

 "Juuust checking! Now, let's see..."

 Razor turned his gaze to the display again.

 "Yes, this was his last location... That's strange - it's only fifteen meters

away, but there's nothing there unless that big... mangrove... tree..."

 Razor looked up and then he saw it.

 "Viper's lab!" - both kats said simultaneously.

 They swam to the big mutated tree and climbed it up. They spotted the entrance

and blasted it with a double kick. They broke into the lab with their glovatrixes

ready.

 The lab was immersed in a natural semi-obscurity. When their eyes accustomed to

the difference of light, they checked the room. It was big, with rude lab benches

made out of vines. The shelves on the rough, dull green and brown walls were also

crude and knotty.

 But, something was wrong.

 It wasn't the obscurity.  Rather it was the sepulchral silence.

 "They're empty..." - T-Bone whispered.

 Razor frowned.

 "What's empty?" - he replied in the same tone, not taking his eyes from the

room.

 T-Bone tensed his muscles. His eyes swung from one side of the room to the

other.

 "Everything. There's nothing on the tables. There's nothing on the shelves.

You'd think a lab would be stuffed with glasses and gizmos, wouldn't you? This

means..."

 "They're expecting us!" - Razor completed as he tensed his muscles too.

 "Right you are, SWAT Kats!"

 Ci-kat-a pushed both SWAT Kats from behind. They fell on the ground and rolled

onto their backs, regaining their feet.

 "Stop right there!" - Razor said as he trained his glovatrix on Ci-kat-a.

 A whooshing sound came from his left. Something scaly snapped him in the

side of his torso and made him fall over T-Bone. The pain was sharp, as

if he had been whipped. He looked to his left and saw two glowing, yellow

eyes. Razor narrowed his.

 "Viper! I knew I should have killed you when I had the chance!"

 He scrambled to his feet again. They were surrounded. The lights were turned

on, blinding them for moments. T-Bone kept his glovatrix aimed at Ci-kat-a

while Razor aimed at Viper. They were back to back. There was no room to fight

and even less to escape.

 "You get Viper, I'll handle the bug!" - T-Bone whispered - "On the count of

three we attack! One... Two... THREE!

 Razor lunged over Viper, knocking him to the ground. He punched the green kat's

face.

 Viper, however, managed to unsheathe his claws and swished them on Razor's

right arm but only ripped his sleeve. Razor got up with a back flip.

 T-Bone somersaulted forward and extended his right leg while in the air,

hitting Ci-kat-a in the head. The bug-kat ducked to the ground with the

blow. T-Bone lifted his left leg and tried to stomp on the bug-kat's head,

but Ci-kat-a rolled away and he missed.

 Ci-kat-a got up to his feet and regrouped with Viper. The SWAT Kats did the

same.

 "Now! Use it!" - Viper ordered.

 Ci-kat-a's antennae started quivering and from all around the SWAT Kats

thousands of insects, from beetles to roaches, appeared almost out of nowhere.

 "What the..." - T-Bone said in a weak and shaky voice.

 "HAH! It won't be a few bugs that'll stop me!" Razor jumped over the bugs and punched

Ci-kat-a.

 The bug-kat lost his concentration and the bugs became confused.

 Viper intervened and snaked his tail around Razor's neck, lifting him from the

ground and smashing him against the wall. Ci-kat-a recovered enough to control the bugs

again.

 Razor dug his claws into Viper's tail, but the green kat just tightened the

grip even more. Soon, Razor was having trouble breathing.

 T-Bone moved back a few steps, but the bugs kept coming towards him. They

started crawling up his legs. The big tabby quivered visibly. His eyes were

wide open, as was his mouth. His breath came in gasps.

 The bugs kept crawling up his legs and onto his torso. Thousands of them

were literally covering T-Bone's body.

 His breathing came in shorter and more frequent gasps. His heartbeat was

very accelerated. He was panicking. His mind was blocked. His eyes were

glazed.

 The bugs kept coming. They were on his chest now and covering his arms.

 T-Bone's mind flashed, flying back to when he was a teenaged kitten. He saw

a dark form near him. Then, the flash ceased.

 Razor looked at his partner. He was locked in Viper's lethal grip and could

do nothing to help his friend.

 Another flash. This time he felt something raspy scrubbing the curve of his

neck and shoulder. Then, it was over again. He shivered. The panic overwhelmed

his mind.

 "NOOOOO!" - he screamed out at the top of his lungs, placing his paws

on his head.

 T-Bone knelt to the ground with his eyes tightly shut.

 A primal fear overwhelmed the big tabby, a fear he couldn't understand nor

control.

 "NO! MAKE IT STOP! PLEASE, MAKE IT STOP! AAAAAAAAAAAHHHHHHHH!"

 He slumped to the ground in fetal position, screaming in what appeared to be

pain.

 Ci-kat-a called back the bugs, but T-Bone still lay on the ground, rocking

from side to side, babbling softly and crying.

 "I don't wan' it! I don't wan' it! Please stop it! I don't wan' it!

I don't wan' it!"

 Razor was astonished! He knew his buddy was an entomophobe, but he never expected

that he would react that way. Now, as he was lying on the ground rocking from

side to side and stammering the same thing again and again, he seemed as

defenseless as a newborn kitten.

 In fact, he seemed insane! Could it be that T-Bone's mind couldn't cope with

the fact he was being attacked by thousands of bugs and simply crossed the thin

and blurred line that separates a normal mind from complete madness?

 There he was. The big tabby, the powerful T-Bone, the all-around

Chance Furlong... Lying in the floor... Crying like a baby...

 Fear can change one during a moment, but panic can destroy one's soul

forever. And in that moment, T-Bone was defeated, destroyed, finished...

 "Take thisss piessse of crud out of my sssight. Lock him in the other room."

 - Viper ordered Ci-kat-a.

 Razor squirmed, trying to get rid of Viper's hug. But, it was hopeless.

 Viper brought Razor closer to his face. He brought him so close that

their noses were almost touching each other.

 "As for you, SSSWAT Kat, I'll make your demise *very* painful and *exssstremely*

long!"

 Viper narrowed his eyes and grinned, sibilating.

 "I haven't forget our lassst encounter. I asssked for your help, but you left

me there to die. Ssso now, you mussst sssuffer for your actionsssssssss!"

 Viper chuckled dryly and slammed Razor's head against the wall. The last

image Razor saw before his world turned black was the evil grin of Dr. Viper.

-------------------------------------------------------------------------------------

 Razor woke up in a darkened, featureless room. He blinked and tried to get his

bearings but, besides the living wall around him, there was nothing identifiable.

 Or was there?

 He thought he had heard something. Breathing. Someone was there with him.

 "T-Bone? Is that you?" - he asked, but his voice was groggy and his throat

ached.

 "I'm here, buddy..." - T-Bone's voice came to him, tired and mournful.

 "Where are you? I can't see you! It's too dark!"

 Razor tried to raise himself from the ground but something stopped him. Only then

did he notice that he was tied up.

 "How are you doin', pal?" - he asked, remembering T-Bone's condition sometime

ago.

 "Better... Given the circumstances."

 "What happened back there?"

 "I'd rather not to talk about that, if you don't mind..."  T-Bone closed his eyes

and dropped his head to his chest in the dark. He didn't want to think about it.

 He didn't want to *remember* it!

 He wanted to sweep that from his life. But, despite his best efforts, it would

always come back to his mind, ready to torment him.

 Ghosts from the past haunting the present.

 Suddenly, the room was invaded by a faint light.

 "Aahh, I sssee you woke up already."

 Viper let the door open so that some light could enter the room.

 The big tabby moaned softly as his eyes were adjusting to the new light

conditions. Razor looked back and saw him. He gasped.

 T-Bone was imprisoned high against the wall, arms and legs spread in 'X'. His

shackles were nothing but living portions protruding from the wall, gripping

his wrists and ankles tightly.

 "T-Bone..." - Razor said in a weak voice. Then, he turned to Viper, rage

burning inside his chest.

 "What did you do to him?" - he asked through clenched teeth.

 Viper just laughed dryly.

 "Don't worry about *him*! It'sss *yourssself* you should be worried

about! I'm going to finish you off from all sssides! Firssst, I'm going to

ruin your image in Megakat City. Then, I'll torture you ssso much that

you'll be even more insssane than I am when I'm finished with you. Finally,

I'll mutilate you and *eat* you piessse by piessse while you're ssstill

alive! I'll drink from your blood and feassst on your flesh while I delight

myssself hearing your deliriousss and bloodcurdling cries of pain and your

implorationssss for mersssy!"

 Viper sibilated loudly as his eyes acquired an intense yellowish glow.

 Razor gulped. He knew Viper was insane and hated him enough to do just

what he said. But, he wouldn't give up right now.

 "What about T-Bone? What do you intend to do with him?"

 "That will come in itsss time. Right now, you'll be doing all my dirty

work! For startersss, I want you to rape Megakat Biochemical Labsss of

all the chemicalsss I require!"

 "And, if I refuse?" - Razor asked defiantly.

 "I was *really* needing a ssstrong and healthy lab rat for my

experimentsssss..." - he said thoughtfully, rubbing his chin - "Your partner fulfillsss

both my requirementssssss..."

 Razor dropped his head. He couldn't put T-Bone's life at stake because of him.

 "Well, SSSWAT Kat? What'sss it gonna be?"

 "Can I talk to my partner alone for a few minutes?"

 "Permission granted. You have three minutessss," - Viper said after thinking

a bit. He left and closed the organic door.

 "What do I do, buddy?  Give me some advice, 'cause I dunno what to do now!" -

Razor asked, eyes abated..

 "Run away! Accept Viper's task and then run away! Save yourself!" - T-Bone

answered intensely.

 "But, he'll experiment on you! I can't bear to think of that!"

 "Don't worry about me! Save your tail!"

 "I can't... I can't leave you behind! You'll suffer a thousand deaths at

Viper's paws! I couldn't bear to carry that burden on my back the rest

of my life!"

 "I'm relieving you of that burden! *Get*...*the*...*heck*...*outta*...*here*!"

 Razor closed his eyes and dropped some tears. It was happening. His nightmare.

T-Bone could die because of him. He was putting T-Bone's life in jeopardy!

 "What do I do?" - he thought - "If I escape, T-Bone gets mutated! If I accept

Viper's task and if something doesn't please him, he could mutate T-Bone just

to punish me! What do I do? What do I do?"

 "Time'sss up! Conversssation endsss now!" - Viper shot as he opened the door.

 Razor closed his eyes, both to protect them from the luminosity from

outside and as a sign of resigned defeat.

 "Well, what did you dessside?"

 "I'll do it, Viper... I'll rob the Labs for you..." - he sighed.

 "I knew you wouldn't defy me!" - Viper went inside and snapped the ropes with

his claws - "Come with me."

 "What about T-Bone?"

 "He's not going anywhere."

 They left the room and closed the living door again. T-Bone stood there in the

darkness. He dropped his head to his chest.

 "Jake, get the heck outta here!" - he thought - "Don't mind about me - just save

your tail! Don't let the name of the SWAT Kats be dragged on the mud."

----------------------------------------------------------------------------------------

 "Commander, the tapes got something!"

 Feral followed one of his Enforcers to a viewing room in M. B. Labs. The lab

had been robbed the previous night and several chemicals were missing. Feral

didn't need to view any security tape to know that Viper would be behind it.

They entered the viewing room.

 "Commander, you won't believe this. Camera 13 caught some great shots of the

robber!" - one of the night watchers said as he stepped aside and played the

video.

 Feral opened his mouth when he looked to the black and white monitor. A slim

form dressed in a G-suit was stealing the lab. The kat was intentionally looking

for some chemicals and, when he'd found them, he'd put them in his backpack. Then,

he looked directly at the camera. His mask and his features became clearly

visible.

 The night watcher froze the picture.

 "Clawson!" - Feral thought - "But why?"

 He inspected the monitor. Razor's face seemed strange. Almost as if he was

regretting what he was doing.

 "Well, Commander, seems like we have our kat!"

 Feral closed his eyes and sighed. What the heck was going on? Did Conway

and Hackle screw something up?

 "Commander?"

 Feral had no choice. The evidence was there, right in front of him. Razor's

face was unmistakable as was his outfit, even in B&W. He opened his eyes and

left the room, heading downstairs to Sergeant Reeves, who was talking to

Felina.

 "Sergeant, put out an APB on the SWAT Kats. If they set one claw in this town,

I want them brought in," - he said mechanically, surely an effect of the

years of training.

 "Yes, Sir!" - Reeves said, saluting his commander and leaving.

 "Uncle, what's happening?"

 Feral took Felina aside, so they could talk in some privacy.

 "What's up, uncle? Why do you want to arrest the SWAT Kats this time?"

 "Clawson did it! He robbed the Labs!"

 "*What*?"

 "I'm not making it up! Security cameras got him in action! He was stealing

the chemicals! I saw it with my own eyes! I couldn't believe it too, but

cameras don't lie!"

 "It can't be..." - she murmured in shock.

 Feral simply shook his head.

 "Though painful it is to admit that my own son and his friend are criminals,

the SWAT Kats robbed this lab and it's our duty to arrest them, Felina. And,

that's exactly what we're gonna do!"

---------------------------------------------------------------------------------------------

 "Today's news. Megakat Biochemical Labs has been robbed and Megakat City

Enforcers are already chasing the criminals. Commander Ulysses Feral had

this to say."

 The small picture in the right upper corner enlarged until it covered the

entire screen. Amid tens of reporters and with his fur glistening because

of the flashes from the cameras, Feral spoke.

 "The security video cameras inside the Labs caught good shots of the

perpetrator. SWAT Kats, wherever you are, you'd better turn yourselves

in. No further comments, please."

 Viper turned off the small TV set and grinned.

 Ci-kat-a came to him.  "You seem pleased. Bzzz-zzz!"

 "I am. Finally, I'm dessstroying my enemiesssssss. Yesssssss, Ci-kat-a.

Revenge is ssssssweet. I guess it'sss time for another dose of methionine,

isssn't it?"

 Viper turned away to the lab bench to prepare some concentrated methionine.

 The bug-kat stayed behind, sunk in his own thoughts.

 "Yes, it is, Viper... Revenge is sweet... And, it should be well savored..."

-------------------------------------------------------------------------------------------

 "You did *what*?" - T-Bone asked in disbelief.

 Razor was with him, inside the darkened room again. He lowered his ears

and hung his head, eyes shut. He had never felt so ashamed in his entire life.

 "I did what Viper told me to do..." - he said in a sheepish tone.

 T-Bone rolled his eyes.

 "Didn't I tell you to *run away*? Now were *both* Viper's prisoners *and*

pursued outlaws!"

 Razor knelt before T-Bone and dropped his head to his chest, arching his

back forward, staring at the ground.

 "I'm... I'm sorry, buddy... I... I just... I just didn't want to be alone

again..."

 That comment struck T-Bone like a punch in his gut. He did it for *him*!

Razor robbed the Labs because he *cared* for his well-being! He sadly

shook his head. Wouldn't he do the same for Razor? Of course he would.

 "But you're not alone, Razor! You have a family... Friends... People that

rely on you... You've got... Callie..." - T-Bone said in a soothing tone.

 "But ,I wouldn't have you..."

 Razor got to his feet and went to T-Bone. He meant to lay a paw on his

shoulder but the big tabby was too high for him to reach. He just laid

a paw on his chest, such a light touch T-Bone hardly sensed it.

 T-Bone felt the urge again. The urge to protect Razor from everything bad in

this world. The urge to protect his little brother...

 "We'll get through this..." - Razor said - "Together... As we always do..."

-------------------------------------------------------------------------------------------

 "It'sss done. Here. Drink up!"

 Viper handed the test tube with the concentrated methionine.

 Ci-kat-a took it in his shaking paws. He stared at the whitish liquid. If

he could do any expression, he would have grinned. The bug-kat threw the test

tube against a wall. The glass container shattered and the liquid spread over

the dull brown and green wall.

 "What wasss *that* for?" - Viper hissed. He sensed something was wrong.

 "Fool! Did you think you could *really* control me? Thanks to your operation

I can now finish my metamorphosis! I'll turn into a space insect, with *their*

original genome! Your little modifications on Street's genome will cease to

exist!"

 Ci-kat-a bent over himself, grabbing his abdomen. The bug-kat made a few buzzing

and shrieking sounds before roaring out loud. A crack began forming on his back

and, suddenly, the bug-kat's skin opened up in two. Stepping out of the slime

inside the empty shell, a purple bug-kat with red multifaceted eyes and red membranous

wings shrieked out loud.

 The transformation was complete. Dr. Harley Street completely ceased to

exist. In his place stood a true alien bug, a true ci-kat-a.

 Viper gasped as he watched the transformation. What an amazing specimen! Now,

all he had to do was capture it again. And then, he would study it again and

then he would control it again and then he would mutate it again and...

 The ci-kat-a leapt towards Viper, tackling him to the opposite wall. The thump

drew all the air out of Viper's lungs. The space bug grabbed him by his tail and

threw him over the lab bench, causing him to shatter everything that was on it.

 Viper rolled over the table and tumbled down onto the ground. Test tubes and

Erlenmeyer beakers crashed and spilt their contents all around him. He stood

on all fours.

 He quivered.

 It was happening again.

 His reptilian instincts were overthrowing his kat condition. He grabbed his

head as his eyes glowed bright golden.

 "No!" - he hissed - "I don't want to..."

 But, it was too late. He looked back at the space bug. His eyes narrowed and

glowed even more. He began salivating and instinctively fully revealed his

claws. He acquired a fighting stance, with his tail raised behind him and

his upper torso bent to the ground. He sibilated and then he roared.

 The ci-kat-a attacked the green kat, but Viper spun his body and slammed

his tail into the bug's side, making him crash against a shelf-covered wall,

breaking all the glass containers and spilling them all over him.

---------------------------------------------------------------------------------------

 The SWAT Kats heard the first roar of Ci-kat-a when he began his metamorphosis.

Then, they heard the sound of glass breaking and, a little later, another roar.

 "What the heck is happening outside?" - T-Bone asked.

 "I dunno, buddy! But it sounds like a fight!"

 Razor went to the organic door and placed his ear against the living door.

For a moment, he just heard more glass breaking. Then, the door blasted

inward and threw him near T-Bone.

 Viper and the ci-kat-a were entwined on each other. They broke apart and

the ci-kat-a spat a volley of yellow slime towards Viper. He ducked and

lunged towards the space bug. His claws were ineffective against the

chitinous exoskeleton under the space bug's fur. He jumped back and

then snapped his tail against the ci-kat-a.

 The space bug crashed against Razor, falling on top of him. The bug fell

with his belly up and strained to regain his feet. Meanwhile, Razor tried

to pull himself from under the bug. The ci-kat-a felt the strange object

squirming under him and attacked.

 The ci-kat-a bit Razor in his arm. The kat let out a cry of pain and quivered

intensely for a while.

 The ci-kat-a regained his stance and lunged towards Viper. They rolled out

of the room and into the laboratory again. The space bug punched Viper

in the head. The green kat lost his concentration for a while, but it was

enough for the organic shackles that kept T-Bone bound to loosen their

grip around the big tabby's wrists and heels.

 He jumped away from the wall and went to Razor. The slim kat was lying on

the floor, with his face buried in the ground. T-Bone turned his friend

around and gasped when he saw him.

 Razor's brain put together the thousands of images his compound eyes were

receiving and a mosaic-like image of T-Bone formed. He hissed and tried to

bite T-Bone.

 "You can't escape from our master!" - Razor buzzed - "Just one bite and

you'll be on our side!"

 T-Bone jumped away when Razor swished his deadly claws across his chest.

The slim kat lunged at T-Bone and pinned him to the ground. His jaws were

salivating and his razor-sharp fangs seemed to glisten in the soft light

from outside the room. He sneered and snarled, trying to bite T-Bone. The

big tabby just barely managed to keep his friend away from him.

 Viper was thrown over the balcony of his tree and fell in the water. The

ci-kat-a blindly plunged down after him. Viper came to the surface in order

to breathe. He spotted the ci-kat-a a few feet away from him. He dived and

swam underwater until he saw the bulk of the space bug. Still underwater,

he snaked his tail around the ci-kat-a's neck and pulled him down while he

went to the surface and swam to the aerial roots of the huge mangrove tree

that housed his lab. The bug squirmed under the water, but Viper's grip on

his throat was tight. Soon, the ci-kat-a stopped moving. Viper let the bug

stay underwater for a while longer, just to make sure. Then, he released the

bug.

 The limp form of the insect rose to the surface and slowly drifted along with

the soft current, later disappearing under the muddy waters of Megakat Swamp.

 Viper climbed up the tree and stepped into his lab. He looked around and saw

it all destroyed. Then, he heard something else. Muffled sounds. Coming from

the room where the SWAT Kats were. He ran there and saw T-Bone still struggling

to release himself from Razor's attack. Viper snapped his tail against Razor,

sending him against the wall. Without a word, he ordered his living vines to

grab the slim kat and hold him tightly against the wall.

 T-Bone got to his feet and stared first at Razor then at Viper.

 The mutated kat was panting. The glow in his eyes faded a bit and he

blinked tiredly.

 T-Bone ran to Viper.

 "Viper, you gotta do something!"

 "What you want me to do?" - Viper asked between pants.

 "Restore Razor to his original condition! I know you can do it!"

 "What makesss you think I would do sssuch thing?" - he asked disdainfully.

 "You owe me one, Viper! A year ago I saved your tail! Now, all I ask is for

you to save him!"

 Viper looked to T-Bone. He knew it was painful for the big tabby to see his

partner like that. The green kat closed his eyes and turned away from T-Bone.

 T-Bone was desperate. Viper wasn't going to help. Razor would become a ci-kat-a

like Harley Street! No! He couldn't allow that! He tumbled to his knees. His

head hung down in humble pleading. He shut his eyes and clenched his teeth.

 "Please, Viper... Help my friend... You can do whatever you want with me but

just help Razor... Please..."

 Viper stopped and turned around. He was surprised to see the big tabby on his

knees, begging for him to spare Razor the torment of becoming a mutated space

bug. He walked to T-Bone and crouched in front of him.

 "Why do you care about him? He'ssssss doomed and you're not! Why don't you

jussssst leave him behind!"

 The big SWAT Kat looked up at Viper. A single tear dropped from T-Bone's

left eye and raced down his facial fur.

 "Because he's my family... I'm sure you know how it feels when someone in

your family gets hurt... Well, it's the same thing I'm feeling now... Razor's

like a brother to me..."

 A brother... A family... Those words struck Viper with the strength

of a powerful kick. Softly, he wiped the tear out of T-Bone's face.

 "I'll help your friend... But, you mussst ssstay here inssstead of him. That's

my only condition. Do we have a deal?"

 T-Bone shook his head yes without hesitation. Viper rose from his crouching

position and T-Bone stood to his feet again. He followed Viper outside the room and

into his lab.

 "But, there'sss nothing I can do here! My lab is in piesssesssssss!"

 "Then..."

 "I sssaid I'd help your friend and that'sss what I'm going to do! I alwaysss

keep my promissses, SSSWAT Kat. We mussst go for the volcano in Megakat

National Park."

 "To the volcano? Why?"

 "You're not here to make questionsss! You're here to obey me! Did you forget

our deal?

 "No... I didn't..."

 "Then, let'sss go. We have a long walk ahead of usss."

 "Who said we're walking?" - T-Bone smirked.

 Viper just gave him an inquiring gaze.

---------------------------------------------------------------------------------------

 "No wonder you defeated me ssso many timesss. Thisss jet isss amazing!"

 "And, you haven't seen anything yet!" - T-Bone smirked as he landed the

TurboKat outside the dark cone-shaped mountain.

 "Let'sss go. The path isss sinuousss and long," - Viper said as he jumped

out of the cockpit.

 T-Bone followed in his steps.

 Half an hour later, they both stood in the laboratory Dark Kat built for

Viper inside one of the lava tubes of the volcano.

 Viper worked swiftly. He analyzed the blood sample he took from Razor and

isolated the mutagenic agent in the ci-kat-a's saliva that caused the

mutation. He also found some hemoglobin molecules with central ions other

than iron.

 "Amazing! A mutagen *and* the neurological ssserum together! Ssso that's

how they controlled their victimsss' mindsss! Well, a dose of consssentrated

hemoglobin takesss care of the ssserum, but the mutagen can only be fought

back with anti-mutagenssss! Fortunately, Dark Kat had this lab well-equipped.

Fetch me those Erlenmeyersss, T-Bone!"

 The hours elapsed. Viper worked feverishly, mixing and separating, isolating

and amplifying. T-Bone soon lost interest. His high-school basic genetics

didn't allow him to fully understand what was being done. He slumped against

the wall and fell asleep, exhausted.

 Viper looked at him for a while. He felt a wave of sympathy for that kat.

It was amazing. That SWAT Kat single-handedly reached the deepest feelings

of his kat soul. He walked to him and gently shook him.

 "It'sss nearly over. I'll jussst let the PCR work for a few hoursss ssso we

have enough vaccine for your friend."

 "Thanks, Viper."

 "Don't thank me. After all, you'll be my ssslave for the ressst of your

life..."

 "Did you really mean what you said about Razor?"

 "About eating him alive?" - Viper laughed dryly - "Of courssse not! You two

have been jumping around for all these yearsss! Your musssclesss musst be

rock-hard! I was planning to roassst him before eating in order to tenderize

the flesh!"

-------------------------------------------------------------------------------------------

 Again in Viper's lab in the swamps, Viper stuck the needle of a syringe into

Razor's arm. The slim kat shuddered for a while and then became unconscious.

Viper released him.

 T-Bone flew them all until they reached the perimeter of Megakat City. T-Bone

laid the still unconscious form of Razor on the grass of a hill.

 "Come on, T-Bone! We should be heading back to the swampsssss," - Viper hissed

in an ice-cold voice.

 "Can I say goodbye to him?" - T-Bone pleaded.

 "Be ssswift."

 T-Bone knelt beside Razor and gently squeezed the slim kat's left shoulder with

his gloved paw.

 "Goodbye, Jake..." - he murmured - "Next time we see each other we'll be

fighting among ourselves. Or you won't recognize me from my mutations. Or

I may even never see you again..."

 A heavy tear streaked his facial fur.

 "Goodbye, little brother... I'll miss you so much..."

 The big tabby got to his feet and turned around.

 "Okay, Viper, let's... Viper?"

 He was gone. Dr. Viper was gone!

 T-Bone looked around but saw nothing. Not even the slightest shadow of Viper.

 He left!

 He left them there!

 "Thank you, Viper..." - he thought as a few more tears raced down his face

- "Thank you for healing Razor... and for allowing me to stay with my

brother..."

 Then, he heard someone mumbling behind him. It was Razor. He was waking up.

 "Wha... What happened? Where am I?"

 T-Bone quickly swept the wetness off his face with his arm. Then, he turned

to Razor. It was good to be back. Good to be free. Good to be with Razor again.

T-Bone told Razor what had happened. They stood there, watching the city.

 "What are we gonna do now, Jake?"

 "Go back to the city and clean our names. Then, we get back in the air, fighting

all the criminal scum that rear their ugly heads on Megakat City."

 "And, we'll do it our way..."

------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------

 EPILOGUE

 »»» A few days later, in a countryside village ««««

 "Mail!" - the mailkat shouted and left. An attractive middle-aged she-kat with

tanned fur and long black hair came to the mailbox and retrieved the letter.

 "That's odd! It doesn't have the sender's name!"

 She opened it and started to read it.

 "Oh, good heavens! Mark, come here, quickly!" - she screamed.

 A middle-aged tom-kat with golden fur came to her.

 "What is it, Martha?"

 She handed him the letter with shaky paws. He grabbed it and read it.

          "For Mark, Martha and Thomas.

          Dear father, dear mother, dear brother.

          I'm sorry I didn't write you sooner. So many things

          happened in my life that the events overwhelmed me.

          I'm fine - don't worry about me. Yes, mom, I've been

          eating properly and getting enough rest.

          Dad, I'm doing what I like and I'm very pleased with

          it. Like you told me, I chased my dream and I sort of

          managed to get it.

          I hope you already got your degree in Mass Communication,

          little bro. 'Cause if you didn't, I'll kick your tail so

          hard that you'll get it in a flash.

          Hope you and Tommy are okay. I miss you all very much.

          I love you all. Dad, mom, bro, you're the most important

          kats in my life.

          Your son and brother

          Elrod Purvis"

-----------------------------------------------------------------------------------------

     THE END

-----------------------------------------------------------------------------------------